What is Life?

Where did it come from?


What is life and where did it come from?

One of the most fundamentally significant scientific discoveries of recent years is the very nature of what life is.
Science has come to realise that every biological system  has  2 basic fundamental  components, on the one hand there is lifeless chemicals and on the other we have the information contained in our genomes that organise those chemicals into the mind-blowingly sophisticated  structures we call life. It is the importance of this information that is built into life that has profound implications as to our understanding of what life is and where it came from.
It is this information that turns chemistry into biology.
A world leading scientist by the name of Craig Ventor, the head of the team that first sequenced the human genome, as well as the team that produced the world’s first synthetic life form, has described life as a software driven process and our genome as our operating system.

Link 1
 
     
Scientists, like Ventor, can now manipulate a cells genome with a computer, load that genome back into a cell and fundamentally change the very nature of the cell.  Our genomes are in a very literal sense a executable computational algorithm that controls life.  Our cells are continually reading and executing parts of that algorithm in every moment of our lives.

Link 2   

     

That is a very bold statement.  But to understand why that is the case we need to take a closer look at the very nature of information itself and in particular the type of information found in life, that is Specified  Functional information , sometimes referred to as  Prescriptive information ( it prescribes for something)

Link 3
   


This discovery sheds a great deal of light on the question of the origins of life, why?   Because any algorithm, or functional information, of the type we have discovered in life, has only one known source,  that is prior intelligence.

That is a very bold statement.  But to understand why that is the case we need to take a closer look at the very nature of information itself and in particular the type of information found in life, that is Specified  Functional information , sometimes referred to as  Prescriptive information ( it prescribes for something)

  Link 3
   
And not just us, every living thing on this planet, from Bacteria to butterflies from plants to polar bears, runs a
variation of the same software program. This planet with its absolute abundance of life, fair hums, as  countless
numbers of biological computers  process information of such vast quantities that that by comparison the internet pales into insignificance in terms of the volume of the information processed. It is not just the quantity of information that is impressive it is also the quality and sophistication of those programs.
Some years ago Bill Gates described the information in life as being like a computer program but far more advanced than any software we have created.

This discovery sheds a great deal of light on the question of the origins of life, why?   Because any algorithm, or functional information, of the type we have discovered in life, has only one known source,  that is prior intelligence.

What is Semiosis ?

Understanding semiosis

To illustrate how semiosis functions consider these next four lines of text.

1.  Turn anticlockwise to undo
2.  Gire en sentido antihorario para deshacer
3.  Yoeiul ivdieqpt yhop j tweind oo lpvoeacpem
4.  acaagatgcattgtccccccgcccttccgatattag

You will no doubt recognise the top line as a clear functional instruction written in the English language. You may or may not recognise the second line of text as the same instruction written in Spanish. That will obviously depend on whether you have learned the conventions around the Spanish language. The conventions involved are complex and extensive and must be observed carefully to enable your own attempt at communicating in Spanish to be effective.

If it is not your mother tongue, it no doubt took considerable intellectual effort on your part to master the Spanish language.

The third line you will not recognise. Although it uses the same physical letters in its construction, this line of text does not conform to any pre-existing conventions, there is no semiosis, and it is total gibberish.

If you have not learned to read Spanish you may well not be able to determine the difference between lines two and three but this does not alter the fact that line two is semiotic and the product of an intellectual process while line three is not.

Line four is the interesting one. Like line two, you may or may not recognise this as an alphabetic representation of the nucleotide bases that make up a short section of DNA.  Science is now beginning to understand how information like this is read and what it means. They are beginning to understand the semiotic conventions that underpin the informational functions of DNA.

Link 5

For example, the nucleotide bases that form the rungs of the DNA ladder are read three at a time, in a way to form something like words, all three letters long.  These "words" are known as Codon’s. The last three letter Codon in line four is TAG. This is known as a stop Codon and is used to signal to the genetic machinery that reads and translates this information to stop reading. There is much to be said about the sophistication of the genetic code.

The semiotic conventions involved in translating this genetic code are complex and extensive and must be carefully and rigorously observed to ensure the function of this information is not destroyed. Without the supporting conventions, lines one, two and four would be as much gibberish as line three.

All four lines are made up of the same letters, it is the pre-existence of the necessary conventions that gives these three sequences of text their function.

The actual DNA genetic code of course is not actually composed of letters but the sequence of chemical bases stores and conveys information in the same way that Braille, machine code or the peaks and pits of a CD disc stores and transmits information by a semiotic process.

Intentionality

Every semiotic system displays a quantifiable degree of intentionality  because of the number of pre-requisite processes that have to be gone through first before you can even begin to convey your intended message.
Semiosis is inextricably linked with intentionality.

Deducted information

Let me contrast this with another form of information we could call deducted information.

For example, Scientists observed the unexpected colour of light coming from distant stars and they then deduced that this was caused by the stars receding away from us. Hence they discovered our expanding universe. Geologists observed that continents had complimentary shapes that appear to be able to fit together like pieces in a jigsaw puzzle.  As a result they deduced the continents were shifting apart.

Deducted information  has no pre-existing conventions that steers someone to the correct conclusion. The interpretation of the raw phenomena has to be painstakingly uncovered by trial and error. Science arrives at conclusions by a deductive process.  This is known as the scientific method, and is how science works.

However it has to be noted at this point that when science needs to store or transmit its conclusions to others, it has to use a semiotic system to do so. (text, speech, computer code etc.) There is no other way!

By contrast, semiotic information does not need the deductive process as long as you understand the conventions to translate, because someone else has already done the hard work for you.

A mind is required

There is an important class of semiotic information that also sheds light on this subject and that is a semiotic system that is read by a computer. Just as in the genetic code of life, there is no conscious mind directly involved in the operation of the software process in a computer.

But behind a computers operation we have software engineers that have to write first the conventions to be used, usually referred to as the computer language, then the actual functional code for the specific application as well as the receiving algorithm to translate the code into a functional response that a computer can use. Without the input from a software engineer a computer is nothing more than an intricate pile of scrap metal. Wipe a computer’s hard drive of its software and it becomes useless. Turns out, the same is true in life.

We are not conscious of the vast quantity of information processing that goes on in our cells, but it is the unconscious execution of this complex software that keeps us alive. As soon as the software process stops we die. Semiotic information is an intrinsic part of life.  

It is interesting to note that there is a well- funded and extensive scientific project known as SETI, the Search for Extra Terrestrial Intelligence. Scientists are listening for signs of intelligent life from other planets.
What are they listening for? They are listening for the simplest information bearing signal that would indicate an intelligent source. They are listening for examples of Semiosis.  Science clearly understands the connection between Semiosis and intelligence.  And they are happily spending millions of pounds on a scientific project that is predicated on that principle.

Information only comes in two forms

Information can only exist in one of two possible forms, it is either a concept in someone’s mind or it is in a semiotic form.

Consider this, every piece of information in your head has come to you by either a personal deductive process, in which it began and continues as a concept or you picked it up by a semiotic process. The only channel available to you to convey a concept to others is by a semiotic process. Semiosis is a symbolic representation of a concept.
Navigate
Very Sophisticated code
Contact
Follow us